Stem-loop sequence gga-mir-1677

AccessionMI0007411 (change log)
DescriptionGallus gallus miR-1677 stem-loop
Gene family MIPF0000849; mir-1677
Literature search

4 open access papers mention gga-mir-1677
(6 sentences)

Stem-loop
      g  u        a  -              aag 
5' agg uc gauccugc cc gcugaagucaaugg   u
   ||| || |||||||| || ||||||||||||||    
3' ucc ag uuaggacg gg ugacuucaguuacu   u
      a  u        a  a              guu 
Get sequence
Deep sequencing
12267 reads, 80 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr3: 74231861-74231933 [+]
sense
ENSGALT00000025144 ; EPHA7-201; intron 5
Database links

Mature sequence gga-miR-1677-5p

Accession MIMAT0007562
Previous IDsgga-miR-1677*
Sequence

10 - 

uccugcaccgcugaagucaau

 - 30

Get sequence
Deep sequencing715 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-1677-3p

Accession MIMAT0007563
Previous IDsgga-miR-1677
Sequence

45 - 

ugacuucaguaggagcaggauu

 - 66

Get sequence
Deep sequencing11552 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).