Stem-loop sequence gga-mir-1667

AccessionMI0007401 (change log)
DescriptionGallus gallus miR-1667 stem-loop
Stem-loop
   gc   g     g aa            ca     u   ga     
5'   cag agguu u  gagauucugaca  auguu aga  uuga 
     ||| ||||| |  ||||||||||||  ||||| |||  ||| g
3'   guc uccaa a  cuuuaggacugu  uacaa ucu  gaca 
   -c   g     g cc            ag     -   aa     
Get sequence
Deep sequencing
215 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr24: 5291926-5292012 [-]
sense
ENSGALT00000011835 ; DSCAML1-201; intron 33
Database links

Mature sequence gga-miR-1667-5p

Accession MIMAT0026778
Sequence

16 - 

gagauucugacacaauguuuaga

 - 38

Get sequence
Deep sequencing3 reads, 1 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence gga-miR-1667-3p

Accession MIMAT0007550
Sequence

54 - 

uaacaugaugucaggauuuccc

 - 75

Get sequence
Deep sequencing211 reads, 3 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).