Stem-loop sequence gga-mir-1662

AccessionMI0007396 (change log)
DescriptionGallus gallus miR-1662 stem-loop
Gene family MIPF0000918; mir-1662
Literature search

3 open access papers mention gga-mir-1662
(15 sentences)

Stem-loop
      a              u aua        guaug 
5' ucu uggguuugacauca c   cuugggau     a
   ||| |||||||||||||| |   ||||||||      
3' aga acccggacuguagu g   gaacccug     c
      -              c gac        aaaca 
Get sequence
Deep sequencing
18945 reads, 200 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr2: 1839179-1839251 [+]
sense
ENSGALT00000045060 ; VIPR1-202; intron 8
ENSGALT00000008443 ; VIPR1-201; intron 9
AADN04011454.1: 4786-4858 [-]
sense
ENSGALT00000045060 ; VIPR1-202; intron 8
ENSGALT00000008443 ; VIPR1-201; intron 9
Database links

Mature sequence gga-miR-1662

Accession MIMAT0007543
Sequence

10 - 

uugacaucaucauacuugggau

 - 31

Get sequence
Deep sequencing18944 reads, 5 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).