Stem-loop sequence gga-mir-135b

AccessionMI0007390 (change log)
DescriptionGallus gallus miR-135b stem-loop
Literature search

7 open access papers mention gga-mir-135b
(10 sentences)

Stem-loop
   ----------------   g a       uugu   g    g 
5'                 ggu a agagggc    ggg aaag g
                   ||| | |||||||    ||| ||||  
3'                 ucg u ucucuug    uuc uuuc a
   ucguuuuccuuauuuu   g a       ---u   g    c 
Get sequence
Deep sequencing
521 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr3: 37593116-37593182 [+]
intergenic
Database links

Mature sequence gga-miR-135b

Accession MIMAT0007536
Sequence

45 - 

uauggcuuuuuauuccuuuu

 - 64

Get sequence
Deep sequencing520 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).