Stem-loop sequence gga-mir-1655

AccessionMI0007388 (change log)
DescriptionGallus gallus miR-1655 stem-loop
Stem-loop
       aaac        a             gg  u            auu  u 
5' gggg    guguuuca cacugugucagcu  uc uggguaaaugcu   gu c
   ||||    |||||||| |||||||||||||  || ||||||||||||   ||  
3' cucc    cacgaggu gugacauagucgg  gg acccauuuauga   cg c
       --ga        c             gu  u            ---  u 
Get sequence
Deep sequencing
100 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr8: 7519299-7519401 [+]
sense
ENSGALT00000039414 ; LAMC1-201; intron 1
Database links

Mature sequence gga-miR-1655-5p

Accession MIMAT0007534
Sequence

25 - 

ucagcuggucuuggguaaaugc

 - 46

Get sequence
Deep sequencing87 reads, 4 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

Mature sequence gga-miR-1655-3p

Accession MIMAT0026777
Sequence

62 - 

auuuacccauggugggcugaua

 - 83

Get sequence
Deep sequencing13 reads, 3 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).