Stem-loop sequence gga-mir-1653

AccessionMI0007385 (change log)
DescriptionGallus gallus miR-1653 stem-loop
Literature search

1 open access papers mention gga-mir-1653
(1 sentences)

Stem-loop
   u     cc   - ugu   -           cc     u g     g  ucu  u 
5'  cagga  gcu c   ucc cauuuguaugc  agcac g uccug ug   gc a
    |||||  ||| |   ||| |||||||||||  ||||| | ||||| ||   ||  
3'  guucu  cga g   agg guggacguacg  ucgug c aggac ac   ug u
   g     -a   c --u   u           --     u g     -  cuu  g 
Get sequence
Deep sequencing
92 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr9: 14383845-14383948 [-]
intergenic
Database links

Mature sequence gga-miR-1653

Accession MIMAT0007532
Sequence

64 - 

caggagcugugcugcaugcagg

 - 85

Get sequence
Deep sequencing92 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).