Stem-loop sequence gga-mir-1815

AccessionMI0007369 (change log)
DescriptionGallus gallus miR-1815 stem-loop
Literature search

2 open access papers mention gga-mir-1815
(3 sentences)

Stem-loop
   u  cu   --  c      a      au         u 
5'  ug  aac  cu cuuuuu gguuuu  gguuuuguu u
    ||  |||  || |||||| ||||||  ||||||||| u
3'  ac  uug  ga gagaga ccaaaa  ccaaaacaa a
   a  cu   uu  c      c      ac         a 
Get sequence
Deep sequencing
8 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr6: 28124152-28124228 [+]
intergenic
Database links

Mature sequence gga-miR-1815

Accession MIMAT0007512
Sequence

17 - 

uagguuuuaugguuuuguuuu

 - 37

Get sequence
Deep sequencing8 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).