Stem-loop sequence gga-mir-1636

AccessionMI0007366 (change log)
DescriptionGallus gallus miR-1636 stem-loop
Literature search

1 open access papers mention gga-mir-1636
(1 sentences)

Stem-loop
          -- -    u  u         - u    a    --   g 
5' caggcau  c cauc gc gccccguca c ccug uacc  gcu u
   |||||||  | |||| || ||||||||| | |||| ||||  ||| g
3' guccgua  g gugg cg cggggcggu g ggac gugg  ugg c
          cc u    c  u         a u    -    aa   u 
Get sequence
Deep sequencing
15 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr15: 4735876-4735963 [+]
sense
ENSGALT00000004933 ; NCOR2-201; intron 24
Database links

Mature sequence gga-miR-1636

Accession MIMAT0007509
Sequence

52 - 

ugcaggugauggcggggcug

 - 71

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).