Stem-loop sequence gga-mir-1620

AccessionMI0007349 (change log)
DescriptionGallus gallus miR-1620 stem-loop
Literature search

1 open access papers mention gga-mir-1620
(1 sentences)

Stem-loop
   u     au   cu                u      g   acu 
5'  gcaau  ggg  ugauccaaagccuguu aaguca ugg   g
    |||||  |||  |||||||||||||||| |||||| |||    
3'  cguua  ccc  acuagguuucggguaa uucagu acc   a
   a     au   ac                u      a   cuu 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr8: 18552909-18552996 [+]
intergenic
Database links

Mature sequence gga-miR-1620

Accession MIMAT0007487
Sequence

55 - 

acuuuaaugggcuuuggaucac

 - 76

Get sequence
Deep sequencing5 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).