Stem-loop sequence gga-mir-1618

AccessionMI0007347 (change log)
DescriptionGallus gallus miR-1618 stem-loop
Literature search

1 open access papers mention gga-mir-1618
(1 sentences)

Stem-loop
       g  -----cu   u         u   -g   ---u  a 
5' cugc ug       gca ccuggcucc ggc  ucc    gc c
   |||| ||       ||| ||||||||| |||  |||    ||  
3' gacg ac       cgu ggaccgagg ccg  agg    cg g
       g  cucuugu   c         c   ag   uuau  u 
Get sequence
Deep sequencing
36 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr8: 7465626-7465704 [+]
intergenic
Database links

Mature sequence gga-miR-1618-5p

Accession MIMAT0026776
Sequence

9 - 

ugcauccuggcuccuggcgucc

 - 30

Get sequence
Deep sequencing26 reads, 1 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence gga-miR-1618-3p

Accession MIMAT0007485
Sequence

47 - 

gagcccggagccaggcugcugu

 - 68

Get sequence
Deep sequencing7 reads, 3 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).