Stem-loop sequence gga-mir-1612

AccessionMI0007340 (change log)
DescriptionGallus gallus miR-1612 stem-loop
Literature search

3 open access papers mention gga-mir-1612
(11 sentences)

Stem-loop
            -a    a ug        cuu          uuu 
5' cuuuuaagc  ucca u  gcucuuuu   ucuuucuuuu   a
   |||||||||  |||| |  ||||||||   ||||||||||    
3' ggagguucg  gggu a  cgaggaaa   aggaaggaga   u
            ac    c gu        ---          ugg 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr9: 4975873-4975956 [+]
sense
ENSGALT00000009328 ; SEPT2-201; intron 1
Database links

Mature sequence gga-miR-1612

Accession MIMAT0007478
Sequence

52 - 

gaaggaaaaggagcugacuggg

 - 73

Get sequence
Deep sequencing2 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).