Stem-loop sequence gga-mir-1605

AccessionMI0007332 (change log)
DescriptionGallus gallus miR-1605 stem-loop
Stem-loop
            u        -    -       a      gaag      
5' aagagaagu cacagagg guuu caugugu ucucuu    augcu 
   ||||||||| |||||||| |||| ||||||| ||||||    |||| g
3' uucuuuuua gugucuuc cgaa guauacg agagag    uauga 
            -        g    a       a      ----      
Get sequence
Deep sequencing
3 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr4: 63465026-63465113 [-]
intergenic
Database links

Mature sequence gga-miR-1605

Accession MIMAT0007471
Sequence

16 - 

aggguuucauguguaucucuug

 - 37

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).