Stem-loop sequence gga-mir-1576

AccessionMI0007302 (change log)
DescriptionGallus gallus miR-1576 stem-loop
Literature search

1 open access papers mention gga-mir-1576
(1 sentences)

Stem-loop
          cugc   -    g  ----               ------     g 
5' cgccgcg    agg gcgu cc    ccgcuccgcccgccc      cgucg g
   |||||||    ||| |||| ||    |||||||||||||||      |||||  
3' gcggcgc    ucc cgua gg    ggcgaggcgggcggg      gcggc u
          --ca   u    g  ccac               cucgac     a 
Get sequence
Deep sequencing
20 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr13: 18027771-18027865 [+]
antisense
ENSGALT00000012233 ; PPP2R2B-201; intron 2
Database links

Mature sequence gga-miR-1576

Accession MIMAT0007437
Sequence

54 - 

cucgggcgggcggagcggcac

 - 74

Get sequence
Deep sequencing18 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).