Stem-loop sequence gga-mir-1574

AccessionMI0007300 (change log)
DescriptionGallus gallus miR-1574 stem-loop
Literature search

1 open access papers mention gga-mir-1574
(4 sentences)

Stem-loop
       caau   c g    -       u     --a  u 
5' cagc    gcu u ugac uucuccu gucag   gc g
   ||||    ||| | |||| ||||||| |||||   ||  
3' gucg    cga g acug aggagga caguc   ug g
       ucuu   a g    u       -     aua  g 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr10: 5628304-5628377 [+]
sense
ENSGALT00000006114 ; TRPM1-201; intron 6
Clustered miRNAs
< 10kb from gga-mir-1574
gga-mir-1574chr10: 5628304-5628377 [+]
gga-mir-204-2chr10: 5628577-5628677 [+]
Database links

Mature sequence gga-miR-1574-5p

Accession MIMAT0007434
Previous IDsgga-miR-1574*
Sequence

12 - 

cugugacuucuccuugucaga

 - 32

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-1574-3p

Accession MIMAT0007435
Previous IDsgga-miR-1574
Sequence

47 - 

acaggaggaugucaggaagcuu

 - 68

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).