Stem-loop sequence gga-mir-1563

AccessionMI0007288 (change log)
DescriptionGallus gallus miR-1563 stem-loop
Literature search

1 open access papers mention gga-mir-1563
(1 sentences)

Stem-loop
      ccaa    cau   gag   -     -gaa  ug 
5' agc    agca   gau   gaa gcacu    ac  a
   |||    ||||   |||   ||| |||||    ||  c
3' ucg    ucgu   cua   cuu cguga    ug  u
      --ag    aac   --a   a     agua  uc 
Get sequence
Deep sequencing
81 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr12: 783184-783254 [+]
sense
ENSGALT00000042516 ; SNORD69-201; exon 1
ENSGALT00000002455 ; GNL3-201; intron 9
Database links

Mature sequence gga-miR-1563

Accession MIMAT0007422
Sequence

9 - 

gcacaugaugaggaagcacugaaa

 - 32

Get sequence
Deep sequencing74 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).