Stem-loop sequence gga-mir-1555

AccessionMI0007280 (change log)
DescriptionGallus gallus miR-1555 stem-loop
Literature search

1 open access papers mention gga-mir-1555
(2 sentences)

Stem-loop
   ga        a    -     c  -uuc        gu  ucc 
5'   agguguga guca gcaaa cc    acccugcc  gu   c
     |||||||| |||| ||||| ||    ||||||||  ||   u
3'   ucuacgcu cagu uguuu gg    ugggacgg  cg   u
   -c        a    g     u  uuau        ac  uac 
Get sequence
Deep sequencing
174 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 144936070-144936155 [-]
sense
ENSGALT00000043098 ; FARP1-201; intron 12
ENSGALT00000027285 ; FARP1-202; intron 14
Database links

Mature sequence gga-miR-1555-5p

Accession MIMAT0026774
Sequence

15 - 

agcaaacccuucacccugcc

 - 34

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence gga-miR-1555-3p

Accession MIMAT0007412
Sequence

54 - 

caggguuauugguuuuguguga

 - 75

Get sequence
Deep sequencing172 reads, 5 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).