Stem-loop sequence gga-mir-1552

AccessionMI0007277 (change log)
DescriptionGallus gallus miR-1552 stem-loop
Literature search

1 open access papers mention gga-mir-1552
(1 sentences)

Stem-loop
         u    a          c    a     g    gag 
5' ucuaca gggg gguuagugcg ggua gcuag gugu   c
   |||||| |||| |||||||||| |||| ||||| ||||   u
3' aggugu cccc ucagucacgu ucgu cgauc cacg   g
         -    g          c    -     g    aca 
Get sequence
Deep sequencing
2993 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence does not map exactly to the galGal4.0 chicken genome assembly, but is annotated based on a Trace Achive sequence (rzq50a05.g1).

Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr1: 133682276-133682358 [+]
intergenic
Clustered miRNAs
< 10kb from gga-mir-1552
gga-mir-1552chr1: 133682276-133682358 [+]
gga-mir-6543chr1: 133686509-133686616 [+]
Database links

Mature sequence gga-miR-1552-5p

Accession MIMAT0007407
Sequence

15 - 

uuagugcgcgguaagcuagggug

 - 37

Get sequence
Deep sequencing2147 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-1552-3p

Accession MIMAT0007408
Sequence

53 - 

cuagcugcucugcacugacug

 - 73

Get sequence
Deep sequencing845 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).