Stem-loop sequence gga-mir-1551

AccessionMI0007276 (change log)
DescriptionGallus gallus miR-1551 stem-loop
Literature search

1 open access papers mention gga-mir-1551
(1 sentences)

Stem-loop
   --a     u    u  cu        aaa     u    u  ga ua 
5'    ggagu acua ag  agcagcaa   gaacu caga gu  u  a
      ||||| |||| ||  ||||||||   ||||| |||| ||  |   
3'    ucucg ugau uc  ucgucguu   uuuga gucu cg  g  c
   uuc     -    -  uu        gug     -    -  ag uu 
Get sequence
Deep sequencing
325 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr14: 5241007-5241096 [+]
intergenic
Database links

Mature sequence gga-miR-1551-5p

Accession MIMAT0007405
Previous IDsgga-miR-1551
Sequence

15 - 

cuagcagcaaaaagaacuucaga

 - 37

Get sequence
Deep sequencing323 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence gga-miR-1551-3p

Accession MIMAT0007406
Previous IDsgga-miR-1551*
Sequence

57 - 

ugaguuuguguugcugcuuucu

 - 78

Get sequence
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).