Stem-loop sequence mdo-mir-1549

AccessionMI0007274 (change log)
DescriptionMonodelphis domestica miR-1549 stem-loop
Gene family MIPF0001345; mir-1549
Stem-loop
   -cuc        c    - ua     u   u 
5'     gccgggcu guag g  gaagc gag u
       |||||||| |||| |  ||||| ||| u
3'     uggcccga cguc c  cuucg uuu u
   ucga        a    c gc     u   g 
Get sequence
Deep sequencing
40943 reads, 500 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is referred to by the unofficial identifier Mdo-315 in [1].

Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
NW_001586660.1: 16844-16906 [+]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-1549
mdo-mir-1549NW_001586660.1: 16844-16906 [+]
mdo-mir-1549bNW_001586660.1: 16845-16902 [-]
Database links

Mature sequence mdo-miR-1549-5p

Accession MIMAT0026773
Sequence

2 - 

ucgccgggcucguagguagaagc

 - 24

Get sequence
Deep sequencing8972 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-1549-3p

Accession MIMAT0006149
Sequence

40 - 

uuccgcccugcaagcccggua

 - 60

Get sequence
Deep sequencing31971 reads, 5 experiments
Evidence experimental; cloned [1], Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).