Stem-loop sequence mdo-mir-1548

AccessionMI0007273 (change log)
DescriptionMonodelphis domestica miR-1548 stem-loop
Stem-loop
       a      - a     cac      gg 
5' gagg gggcuc c gcggg   gcacgc  g
   |||| |||||| | |||||   ||||||   
3' uucc cucggg g cgucc   cgugug  c
       c      c a     -ua      gu 
Get sequence
Deep sequencing
7281 reads, 66.7 reads per million, 3 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is referred to by the unofficial identifier Mdo-305 in [1].

Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr2: 541547258-541547317 [-]
sense
ENSMODT00000003505 ; IGF2BP2-201; intron 7
Clustered miRNAs
< 10kb from mdo-mir-1548
mdo-mir-7270chr2: 541551023-541551080 [-]
mdo-mir-7269chr2: 541547457-541547520 [-]
mdo-mir-1548chr2: 541547258-541547317 [-]
Database links

Mature sequence mdo-miR-1548-5p

Accession MIMAT0026772
Sequence

5 - 

agggcuccagcgggcacgcacgc

 - 27

Get sequence
Deep sequencing4490 reads, 2 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-1548-3p

Accession MIMAT0006148
Sequence

37 - 

ugcauccugcagcgggcucccc

 - 58

Get sequence
Deep sequencing2787 reads, 3 experiments
Evidence experimental; cloned [1], Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).