Stem-loop sequence mdo-mir-1547

AccessionMI0007272 (change log)
DescriptionMonodelphis domestica miR-1547 stem-loop
Stem-loop
   uaa     g  ug   u    g    uu         -u  --a  u 
5'    agaac ua  aug auca aguc  ggguccuug  gu   ga g
      ||||| ||  ||| |||| ||||  |||||||||  ||   ||  
3'    ucuug gu  uac uagu ucag  ccuaggaac  ca   uu c
   ccc     g  gu   -    -    uc         uu  gag  u 
Get sequence
Deep sequencing
252612 reads, 3.94e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is referred to by the unofficial identifier Mdo-302 in [1].

Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr4: 335163695-335163785 [-]
sense
ENSMODT00000005974 ; USP35-201; intron 3
Database links

Mature sequence mdo-miR-1547-5p

Accession MIMAT0006147
Sequence

17 - 

uaucagagucuuggguccuugu

 - 38

Get sequence
Deep sequencing251368 reads, 5 experiments
Evidence experimental; cloned [1], Illumina [2]
Database links
Predicted targets

Mature sequence mdo-miR-1547-3p

Accession MIMAT0026771
Sequence

57 - 

caaggaucccugacuugaucau

 - 78

Get sequence
Deep sequencing1235 reads, 5 experiments
Evidence experimental; Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).