Stem-loop sequence mdo-mir-1546

AccessionMI0007271 (change log)
DescriptionMonodelphis domestica miR-1546 stem-loop
Stem-loop
   au      cc     uc         c    a      ug ga 
5'   gccuug  ggaaa  agggauucu aggg uggaag  a  c
     ||||||  |||||  ||||||||| |||| ||||||  |  a
3'   cggaac  ucuuu  ucccuaaga ucuc accuuc  u  a
   cc      uu     ua         c    c      ca aa 
Get sequence
Deep sequencing
196036 reads, 3.06e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is referred to by the unofficial identifier Mdo-254 in [1].

Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr3: 518067372-518067460 [-]
sense
ENSMODT00000011437 ; mdo-mir-1546-201; 3'UTR (exon 11)
Clustered miRNAs
< 10kb from mdo-mir-1546
mdo-mir-1546bchr3: 518067388-518067447 [+]
mdo-mir-1546chr3: 518067372-518067460 [-]
Database links

Mature sequence mdo-miR-1546-5p

Accession MIMAT0006146
Sequence

16 - 

ucagggauucucagggauggaa

 - 37

Get sequence
Deep sequencing195887 reads, 5 experiments
Evidence experimental; cloned [1], Illumina [2]
Database links
Predicted targets

Mature sequence mdo-miR-1546-3p

Accession MIMAT0026770
Sequence

55 - 

ccaccucucagaaucccuauuu

 - 76

Get sequence
Deep sequencing148 reads, 3 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).