Stem-loop sequence mdo-mir-1544a

AccessionMI0007269 (change log)
DescriptionMonodelphis domestica miR-1544a stem-loop
Gene family MIPF0001645; mir-1544
Stem-loop
         u  c  ugcac            u  c  uu acu 
5' agcagc gc cc     ccagggauagga ag gg  c   u
   |||||| || ||     |||||||||||| || ||  |    
3' ucgucg cg gg     ggucccuaucuu uc cc  g   g
         c  c  -ucau            u  -  cc aag 
Get sequence
Deep sequencing
43487 reads, 640 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is referred to by the unofficial identifier Mdo-202a in [1].

Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chrX: 14005428-14005509 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-1544a
mdo-mir-1544dchrX: 14010514-14010574 [-]
mdo-mir-1545cchrX: 14007943-14008000 [-]
mdo-mir-1544achrX: 14005428-14005509 [-]
mdo-mir-1545achrX: 14003847-14003918 [-]
mdo-mir-1544c-6chrX: 13998842-13998902 [-]
mdo-mir-1545d-2chrX: 13996260-13996318 [-]
Database links

Mature sequence mdo-miR-1544a-5p

Accession MIMAT0006144
Sequence

13 - 

ugcacccagggauaggauagcg

 - 34

Get sequence
Deep sequencing39876 reads, 5 experiments
Evidence experimental; cloned [1], Illumina [2]
Database links
Predicted targets

Mature sequence mdo-miR-1544a-3p

Accession MIMAT0026768
Sequence

51 - 

ccuuuucuaucccugguacuggc

 - 73

Get sequence
Deep sequencing3611 reads, 5 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).