Stem-loop sequence mdo-mir-340

AccessionMI0007268 (change log)
DescriptionMonodelphis domestica miR-340 stem-loop
Stem-loop
   uggac  u   ca          a   a                    ggua 
5'      gg gau  aggugugacu uaa guaaugagauugauuucugu    u
        || |||  |||||||||| ||| ||||||||||||||||||||     
3'      cu cua  ucuacacuga auu cauuacuuugacuaaaggua    a
   ----u  u   -a          c   c                    aaug 
Get sequence
Deep sequencing
40432 reads, 480 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is referred to by the unofficial identifier Mdo-182 in [1].

Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr1: 72640994-72641094 [+]
intergenic
Database links

Mature sequence mdo-miR-340-5p

Accession MIMAT0006143
Sequence

27 - 

aaguaaugagauugauuucugu

 - 48

Get sequence
Deep sequencing40378 reads, 5 experiments
Evidence experimental; cloned [1], Illumina [2]
Predicted targets

Mature sequence mdo-miR-340-3p

Accession MIMAT0026767
Sequence

61 - 

ggaaaucaguuucauuaccuua

 - 82

Get sequence
Deep sequencing51 reads, 1 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).