Stem-loop sequence mdo-mir-1542-2

AccessionMI0007266 (change log)
DescriptionMonodelphis domestica miR-1542-2 stem-loop
Gene family MIPF0000485; mir-1542
Stem-loop
   ua         cu    caua    cu   -      u  g 
5'   guacagugc  ggca    ggag  uca uaaaug gu u
     |||||||||  ||||    ||||  ||| |||||| ||  
3'   cgugucacg  ccgu    ccuc  agu auuuau ua u
   uc         au    --aa    -u   u      u  g 
Get sequence
Deep sequencing
140213 reads, 1.88e+03 reads per million, 5 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence is referred to by the unofficial identifier Mdo-172b in [1].

Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr8: 87784982-87785061 [-]
sense
ENSMODT00000001566 ; SYN3-201; intron 1
Clustered miRNAs
< 10kb from mdo-mir-1542-2
mdo-mir-1542-2chr8: 87784982-87785061 [-]
mdo-mir-1542-1chr8: 87784786-87784857 [-]
Database links

Mature sequence mdo-miR-1542-2-5p

Accession MIMAT0031061
Sequence

12 - 

cuggcacauaggagcuucauaaa

 - 34

Get sequence
Deep sequencing2075 reads, 4 experiments
Evidence experimental; Illumina [2]
Predicted targets

Mature sequence mdo-miR-1542-3p

Accession MIMAT0006141
Sequence

51 - 

uauugaucuccaaugccuagc

 - 71

Get sequence
Deep sequencing276307 reads, 5 experiments
Evidence experimental; cloned [1], Illumina [2]
Database links
Predicted targets

References

1
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).