Stem-loop sequence mdo-mir-1541

AccessionMI0007264 (change log)
DescriptionMonodelphis domestica miR-1541 stem-loop
Stem-loop
   a     c -g    ug         gga  ug c 
5'  uggag a  augg  ugcucguuu   ug  g a
    ||||| |  ||||  |||||||||   ||  |  
3'  accuc u  uacc  acggguagg   gc  u g
   g     c ag    cu         -ga  gu u 
Get sequence
Deep sequencing
1794466 reads, 3.01e+04 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Comments

This sequence is referred to by the unofficial identifier Mdo-27 in [1].

Genome context
Coordinates (MonDom5; GCF_000002295.2) Overlapping transcripts
chr4: 400891414-400891481 [-]
intergenic
Clustered miRNAs
< 10kb from mdo-mir-1541
mdo-mir-7305chr4: 400892027-400892085 [-]
mdo-mir-7304chr4: 400891596-400891650 [-]
mdo-mir-1541chr4: 400891414-400891481 [-]
mdo-mir-7303chr4: 400890972-400891034 [-]
mdo-mir-1643bchr4: 400890701-400890759 [-]
mdo-mir-7302chr4: 400890546-400890607 [-]
mdo-mir-1643achr4: 400890413-400890471 [-]
Database links

Mature sequence mdo-miR-1541

Accession MIMAT0006140
Sequence

11 - 

uggugugcucguuuggaugugg

 - 32

Get sequence
Deep sequencing1794466 reads, 5 experiments
Evidence experimental; cloned [1]
Database links
Predicted targets

References

1