Stem-loop sequence hsa-mir-103b-2

Accession

MI0007262

Previous IDs

hsa-mir-103-2-as

Symbol

HGNC:MIR103-2AS

Description

Homo sapiens miR-103b-2 stem-loop

Gene family

MIPF0000024; mir-103

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-103/107_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The miR-103 microRNA precursor (homologous to miR-107), is a short non-coding RNA gene involved in gene regulation. miR-103 and miR-107 have now been predicted or experimentally confirmed in human. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. mir-103 and mir-107 were noted as being upregulated in obese mice and were subsequently found to have a key role in insulin sensitivity. This led to a suggestion that these microRNAs represent potential targets for the treatment of type 2 diabetes. mir-103 has also been linked with chronic pain and intestinal cell proliferation.

Stem-loop

uca    -c  g    a        gaccug 
   uagc  cu uaca ugcugcuu      a
   ||||  || |||| ||||||||      a
   gucg  ga augu acgacgga      u
--a    aa  a    c        acaucg 

Genome context

• Coordinates (GRCh37.p5): chr20: 3898149-3898210 [-]
• Overlapping transcripts:

  antisense

  OTTHUMT00000077787 ; PANK2-001; intron 5

  OTTHUMT00000077788 ; PANK2-002; intron 5

  OTTHUMT00000077789 ; PANK2-003; intron 5

  OTTHUMT00000077793 ; PANK2-007; intron 5

  OTTHUMT00000077787 ; PANK2-001; intron 5

  OTTHUMT00000077788 ; PANK2-002; intron 5

  OTTHUMT00000077789 ; PANK2-003; intron 5

  OTTHUMT00000077793 ; PANK2-007; intron 5

  OTTHUMT00000077787 ; PANK2-001; intron 5

  OTTHUMT00000077788 ; PANK2-002; intron 5

  OTTHUMT00000077789 ; PANK2-003; intron 5

  OTTHUMT00000077793 ; PANK2-007; intron 5

  ENST00000362154 ; MIR103A2-201; exon 1

  ENST00000362154 ; MIR103A2-201; exon 1

  ENST00000362154 ; MIR103A2-201; exon 1

  ENST00000497424 ; PANK2-001; intron 5

  ENST00000495692 ; PANK2-003; intron 5

  ENST00000316562 ; PANK2-007; intron 5

  ENST00000336066 ; PANK2-002; intron 5

  ENST00000497424 ; PANK2-001; intron 5

  ENST00000495692 ; PANK2-003; intron 5

  ENST00000316562 ; PANK2-007; intron 5

  ENST00000336066 ; PANK2-002; intron 5

  ENST00000497424 ; PANK2-001; intron 5

  ENST00000495692 ; PANK2-003; intron 5

  ENST00000316562 ; PANK2-007; intron 5

  ENST00000336066 ; PANK2-002; intron 5

  ENST00000399552 ; PANK2-201; intron 6

  ENST00000399552 ; PANK2-201; intron 6

Clustered miRNAs

< 10kb from hsa-mir-103b-2

• hsa-mir-103b-2: chr20: 3898149-3898210 [-]
• hsa-mir-103a-2: chr20: 3898141-3898218 [+]

Database links

• ENTREZGENE: 100302282;MIR103-2AS
• ENTREZGENE: 100313885;MIR103-2AS
• HGNC: 35385;MIR103-2AS

Mature sequence hsa-miR-103b

• Accession: MIMAT0007402
• Previous IDs: hsa-miR-103-as
• Sequence: 1 - ucauagcccuguacaaugcugcu - 23
• Evidence: experimental; ChIP-seq [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-103b
  • MICRORNA.ORG:hsa-miR-103b
  • MIRDB:hsa-miR-103b
  • RNA22-HSA:hsa-miR-103b
  • TARGETMINER:hsa-miR-103b

References

1. PMID:18524951 "Characterization of endogenous human Argonautes and their miRNA partners in RNA silencing" Azuma-Mukai A, Oguri H, Mituyama T, Qian ZR, Asai K, Siomi H, Siomi MC Proc Natl Acad Sci U S A. 105:7964-7969(2008).