Stem-loop sequence hsa-mir-103b-2

AccessionMI0007262 (change log)
Previous IDshsa-mir-103-2-as
Symbol HGNC:MIR103B2
DescriptionHomo sapiens miR-103b-2 stem-loop
Gene family MIPF0000024; mir-103
Literature search

214 open access papers mention hsa-mir-103b-2
(831 sentences)

Stem-loop
   uca    -c  g    a        gaccug 
5'    uagc  cu uaca ugcugcuu      a
      ||||  || |||| ||||||||      a
3'    gucg  ga augu acgacgga      u
   --a    aa  a    c        acaucg 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 4 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr20: 3917502-3917563 [-]
sense
OTTHUMT00000077795 ; RNF24-001; intron 4
OTTHUMT00000252862 ; RNF24-002; intron 4
OTTHUMT00000471914 ; RNF24-003; intron 5
ENST00000336095 ; RNF24-001; intron 4
ENST00000358395 ; RNF24-002; intron 4
ENST00000432261 ; RNF24-201; intron 4
ENST00000545616 ; RNF24-003; intron 5
Clustered miRNAs
< 10kb from hsa-mir-103b-2
hsa-mir-103b-2chr20: 3917502-3917563 [-]
hsa-mir-103a-2chr20: 3917494-3917571 [+]
Database links

Mature sequence hsa-miR-103b

Accession MIMAT0007402
Previous IDshsa-miR-103-as
Sequence

1 - 

ucauagcccuguacaaugcugcu

 - 23

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; ChIP-seq [1]
Predicted targets

References

1
PMID:18524951 "Characterization of endogenous human Argonautes and their miRNA partners in RNA silencing" Azuma-Mukai A, Oguri H, Mituyama T, Qian ZR, Asai K, Siomi H, Siomi MC Proc Natl Acad Sci U S A. 105:7964-7969(2008).