Stem-loop sequence hsa-mir-103b-1

Accession

MI0007261

Previous IDs

hsa-mir-103-1-as

Symbol

HGNC:MIR103-1AS

Description

Homo sapiens miR-103b-1 stem-loop

Gene family

MIPF0000024; mir-103

Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-103/107_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia.

The miR-103 microRNA precursor (homologous to miR-107), is a short non-coding RNA gene involved in gene regulation. miR-103 and miR-107 have now been predicted or experimentally confirmed in human. microRNAs are transcribed as ~70 nucleotide precursors and subsequently processed by the Dicer enzyme to give a ~22 nucleotide product. In this case the mature sequence comes from the 5' arm of the precursor. The mature products are thought to have regulatory roles through complementarity to mRNA. mir-103 and mir-107 were noted as being upregulated in obese mice and were subsequently found to have a key role in insulin sensitivity. This led to a suggestion that these microRNAs represent potential targets for the treatment of type 2 diabetes. mir-103 has also been linked with chronic pain and intestinal cell proliferation.

Stem-loop

ucaua  -c  g    a        gaucca 
     gc  cu uaca ugcugcuu      u
     ||  || |||| ||||||||      a
     cg  ga augu acgacgga      u
--agc  aa  a    c        acaacg 

Genome context

• Coordinates (GRCh37.p5): chr5: 167987909-167987970 [+]
• Overlapping transcripts:

  antisense

  OTTHUMT00000371464 ; PANK3-003; intron 2

  OTTHUMT00000371464 ; PANK3-003; intron 2

  OTTHUMT00000371464 ; PANK3-003; intron 2

  OTTHUMT00000252793 ; PANK3-001; intron 5

  OTTHUMT00000252793 ; PANK3-001; intron 5

  OTTHUMT00000252793 ; PANK3-001; intron 5

  ENST00000362165 ; MIR103A1-201; exon 1

  ENST00000362165 ; MIR103A1-201; exon 1

  ENST00000362165 ; MIR103A1-201; exon 1

  ENST00000520504 ; PANK3-003; intron 2

  ENST00000520504 ; PANK3-003; intron 2

  ENST00000520504 ; PANK3-003; intron 2

  ENST00000239231 ; PANK3-001; intron 5

  ENST00000239231 ; PANK3-001; intron 5

  ENST00000239231 ; PANK3-001; intron 5

Clustered miRNAs

< 10kb from hsa-mir-103b-1

• hsa-mir-103a-1: chr5: 167987901-167987978 [-]
• hsa-mir-103b-1: chr5: 167987909-167987970 [+]

Database links

• ENTREZGENE: 100302238;MIR103-1AS
• ENTREZGENE: 100313904;MIR103-1AS
• HGNC: 35384;MIR103-1AS

Mature sequence hsa-miR-103b

• Accession: MIMAT0007402
• Previous IDs: hsa-miR-103-as
• Sequence: 1 - ucauagcccuguacaaugcugcu - 23
• Evidence: experimental; ChIP-seq [1]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-103b
  • MICRORNA.ORG:hsa-miR-103b
  • MIRDB:hsa-miR-103b
  • RNA22-HSA:hsa-miR-103b
  • TARGETMINER:hsa-miR-103b

References

1. PMID:18524951 "Characterization of endogenous human Argonautes and their miRNA partners in RNA silencing" Azuma-Mukai A, Oguri H, Mituyama T, Qian ZR, Asai K, Siomi H, Siomi MC Proc Natl Acad Sci U S A. 105:7964-7969(2008).