Stem-loop sequence hsa-mir-1537

Accession

MI0007258

Symbol

HGNC:MIR1537

Description

Homo sapiens miR-1537 stem-loop

Gene family

MIPF0000917; mir-1537

Stem-loop

              u a         ccu 
acagcuguaauuag c guuuucugu   g
|||||||||||||| | |||||||||   u
uguugacauugauc g caaaagaca   c
              u c         cac 

Deep sequencing

90 reads, 12 experiments

Genome context

• Coordinates (GRCh37.p5): chr1: 236016300-236016360 [-]
• Overlapping transcripts:

  sense

  OTTHUMT00000097533 ; LYST-001; intron 1

  OTTHUMT00000097534 ; LYST-002; intron 1

  OTTHUMT00000097535 ; LYST-003; intron 1

  OTTHUMT00000097536 ; LYST-004; intron 1

  OTTHUMT00000097537 ; LYST-005; intron 1

  OTTHUMT00000097533 ; LYST-001; intron 1

  OTTHUMT00000097534 ; LYST-002; intron 1

  OTTHUMT00000097535 ; LYST-003; intron 1

  OTTHUMT00000097536 ; LYST-004; intron 1

  OTTHUMT00000097537 ; LYST-005; intron 1

  OTTHUMT00000097533 ; LYST-001; intron 1

  OTTHUMT00000097534 ; LYST-002; intron 1

  OTTHUMT00000097535 ; LYST-003; intron 1

  OTTHUMT00000097536 ; LYST-004; intron 1

  OTTHUMT00000097537 ; LYST-005; intron 1

  ENST00000389794 ; LYST-001; intron 1

  ENST00000489585 ; LYST-002; intron 1

  ENST00000465349 ; LYST-003; intron 1

  ENST00000468107 ; LYST-004; intron 1

  ENST00000468626 ; LYST-005; intron 1

  ENST00000389793 ; LYST-201; intron 1

  ENST00000536965 ; LYST-202; intron 1

  ENST00000389794 ; LYST-001; intron 1

  ENST00000489585 ; LYST-002; intron 1

  ENST00000465349 ; LYST-003; intron 1

  ENST00000468107 ; LYST-004; intron 1

  ENST00000468626 ; LYST-005; intron 1

  ENST00000389793 ; LYST-201; intron 1

  ENST00000536965 ; LYST-202; intron 1

  ENST00000389794 ; LYST-001; intron 1

  ENST00000489585 ; LYST-002; intron 1

  ENST00000465349 ; LYST-003; intron 1

  ENST00000468107 ; LYST-004; intron 1

  ENST00000468626 ; LYST-005; intron 1

  ENST00000389793 ; LYST-201; intron 1

  ENST00000536965 ; LYST-202; intron 1

Database links

• ENTREZGENE: 100302139;MIR1537
• HGNC: 35381;MIR1537

Mature sequence hsa-miR-1537

• Accession: MIMAT0007399
• Sequence: 40 - aaaaccgucuaguuacaguugu - 61
• Deep sequencing: 90 reads, 12 experiments
• Evidence: experimental; ChIP-seq [1], Solexa [2]
• Predicted targets:
  • DIANA-MICROT:hsa-miR-1537
  • MICRORNA.ORG:hsa-miR-1537
  • MIRDB:hsa-miR-1537
  • RNA22-HSA:hsa-miR-1537
  • TARGETMINER:hsa-miR-1537

References

1. PMID:18524951 "Characterization of endogenous human Argonautes and their miRNA partners in RNA silencing" Azuma-Mukai A, Oguri H, Mituyama T, Qian ZR, Asai K, Siomi H, Siomi MC Proc Natl Acad Sci U S A. 105:7964-7969(2008).
2. PMID:20300190 "Characterization of the Melanoma miRNAome by Deep Sequencing" Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK PLoS One. 5:e9685(2010).