|
miRBase |
|
Stem-loop sequence gma-MIR1516a |
|||||
| Accession | MI0007229 | ||||
| Previous IDs | gma-MIR1516 | ||||
| Description | Glycine max miR1516 stem-loop | ||||
| Gene family | MIPF0001353; MIR1516 | ||||
| Stem-loop |
ca a a uguuuggauacaaguuauaagcucuuuugagagcuucucuac g aaauauau |||||||||||||||||||||||||||||||||||||||||| | ||||||| u acaaaccuauguucgguauucgagaaaacucucgaagagaug c uuuauaua ag g c |
||||
| Genome context |
|
||||
Mature sequence gma-miR1516a-5p |
|
| Accession | MIMAT0020937 |
| Previous IDs | gma-miR1516* |
| Sequence |
13 - caaguuauaagcucuuuugagag - 35 |
| Evidence | experimental; SOLiD [2] |
Mature sequence gma-miR1516a-3p |
|
| Accession | MIMAT0007375 |
| Previous IDs | gma-miR1516 |
| Sequence |
81 - caaaagagcuuauggcuugua - 101 |
| Evidence | experimental; 454 [1] |
References |
|
| 1 |
PMID:18402695
"Novel and nodulation-regulated microRNAs in soybean roots"
BMC Genomics. 9:160(2008).
|
| 2 |
PMID:21751852
"Transcriptional analysis of soybean root response to Fusarium virguliforme, the causal agent of sudden death syndrome"
Mol Plant Microbe Interact. 24:958-972(2011).
|