Stem-loop sequence gma-MIR1510a

Accession MI0007222
Previous IDs gma-MIR1510
Description Glycine max miR1510a stem-loop
Gene family MIPF0000703; MIR1510
Stem-loop 
-u       cu  a                ug    -     -   g 
  uauggaa  gg gggauagguaaaacaa  acug cugua uaa u
  |||||||  || ||||||||||||||||  |||| ||||| |||  
  guaccuu  cc ccuuauccauuuuguu  ugau gauau guu a
au       ac  a                gu    u     u   a
Get sequence
Genome context
Coordinates (Phytozome5.0) Overlapping transcripts
Gm16: 31518908-31519000 [+]
intergenic

Mature sequence gma-miR1510a-5p

Accession MIMAT0017338
Sequence

13 -  

agggauagguaaaacaaugacugc

 - 36

Get sequence
Evidence experimental; Solexa [3,5], 454 [4]

Mature sequence gma-miR1510a-3p

Accession MIMAT0007368
Previous IDs gma-miR1510;gma-miR1510a
Sequence

61 -  

uuguuguuuuaccuauuccaccc

 - 83

Get sequence
Evidence experimental; 454 [1,4], Northern [1], cloned [2]

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).
2
PMID:19084500 "Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules" Wang Y, Li P, Cao X, Wang X, Zhang A, Li X Biochem Biophys Res Commun. 378:799-803(2009).
3
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
4
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).
5
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).