Stem-loop sequence gma-MIR1509a

Accession MI0007221
Previous IDs gma-MIR1509
Description Glycine max miR1509a stem-loop
Gene family MIPF0000771; MIR1509
Stem-loop 
cu    -cu  -             u        c --u u -u      -aagaa  u 
  gcau   uc uuaaucaaggaaa cacggucg g   g g  gccgga      ag g
  ||||   || ||||||||||||| |||||||| |   | |  ||||||      ||  
  cgug   ag aauugguuccuuu gugccagc c   c c  uggccu      uc g
--    uau  c             -        u uuu u uu      cuagug  c
Get sequence
Genome context
Coordinates (Phytozome5.0) Overlapping transcripts
Gm17: 10099759-10099869 [+]
intergenic

Mature sequence gma-miR1509a

Accession MIMAT0007367
Previous IDs gma-miR1509
Sequence

11 -  

uuaaucaaggaaaucacggucg

 - 32

Get sequence
Evidence experimental; 454 [1,4], cloned [2], Solexa [3]
Validated targets

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).
2
PMID:19084500 "Identification and expression analysis of miRNAs from nitrogen-fixing soybean nodules" Wang Y, Li P, Cao X, Wang X, Zhang A, Li X Biochem Biophys Res Commun. 378:799-803(2009).
3
PMID:20122185 "Prediction of novel miRNAs and associated target genes in Glycine max" Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G BMC Bioinformatics. 11 Suppl 1:S14(2010).
4
PMID:21504877 "MicroRNAs in the shoot apical meristem of soybean" Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL J Exp Bot. 62:2495-2506(2011).