Stem-loop sequence gma-MIR169c

Accession MI0007212
Description Glycine max miR169c stem-loop
Gene family MIPF0000037; MIR169_2
a   g     a     -              acauuaauuugccauuaagcuaacga 
 agu ggaug agcca aggaugacuugccg                          g
 ||| ||||| ||||| ||||||||||||||                          u
 ucg uuuau ucggu uccuacuggacggc                          u
-   g     a     c              ccuuuuagauuguuuacuaagaugga 
Get sequence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0) Overlapping transcripts
chr9: 5295089-5295203 [+]

Mature sequence gma-miR169c

Accession MIMAT0007357

11 - 


 - 31

Get sequence
Evidence experimental; 454 [18402695], SOLiD [21751852]


PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).