Stem-loop sequence gma-MIR169c

AccessionMI0007212 (change log)
DescriptionGlycine max miR169c stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

23 open access papers mention gma-MIR169c
(121 sentences)

   a   g     a     -              acauuaauuugccauuaagcuaacga 
5'  agu ggaug agcca aggaugacuugccg                          g
    ||| ||||| ||||| ||||||||||||||                          u
3'  ucg uuuau ucggu uccuacuggacggc                          u
   -   g     a     c              ccuuuuagauuguuuacuaagaugga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr9: 5343659-5343773 [+]
Clustered miRNAs
< 10kb from gma-MIR169c
gma-MIR169cchr9: 5343659-5343773 [+]
gma-MIR169wchr9: 5348169-5348283 [+]
Database links

Mature sequence gma-miR169c

Accession MIMAT0007357

11 - 


 - 31

Get sequence
Evidence experimental; 454 [1], SOLiD [2]


PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).