Stem-loop sequence gma-MIR169b

AccessionMI0007211 (change log)
DescriptionGlycine max miR169b stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

23 open access papers mention gma-MIR169b
(98 sentences)

Stem-loop
   uau    c  c                    -uaa     u       uuug       auucauguuugucaauugauagugcauuaguu 
5'    gaug ug agccaaggaugacuugccga    auucu ucucuaa    acuuuca                                c
      |||| || ||||||||||||||||||||    ||||| |||||||    |||||||                                u
3'    cugu ac ucgguuucuacugaacggcu    uggga agggauu    ugaaagu                                a
   uau    -  a                    uaaa     u       ucug       guuaucacaagauauauuaguuuacguauaua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr2: 10504688-10504870 [+]
intergenic
Database links

Mature sequence gma-miR169b

Accession MIMAT0007356
Sequence

11 - 

cagccaaggaugacuugccga

 - 31

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).