Stem-loop sequence gma-MIR169b

Accession MI0007211
Description Glycine max miR169b stem-loop
Gene family MIPF0000037; MIR169_2
   uau    c  c                    -uaa     u       uuug       auucauguuugucaauugauagugcauuaguu 
5'    gaug ug agccaaggaugacuugccga    auucu ucucuaa    acuuuca                                c
      |||| || ||||||||||||||||||||    ||||| |||||||    |||||||                                u
3'    cugu ac ucgguuucuacugaacggcu    uggga agggauu    ugaaagu                                a
   uau    -  a                    uaaa     u       ucug       guuaucacaagauauauuaguuuacguauaua 
Get sequence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0) Overlapping transcripts
chr2: 10422863-10423045 [+]

Mature sequence gma-miR169b

Accession MIMAT0007356

11 - 


 - 31

Get sequence
Evidence experimental; 454 [1]


PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).