Stem-loop sequence gma-MIR169b

AccessionMI0007211
DescriptionGlycine max miR169b stem-loop
Gene family MIPF0000037; MIR169_2
Stem-loop
uau    c  c                    -uaa     u       uuug       auucauguuugucaauugauagugcauuaguu 
   gaug ug agccaaggaugacuugccga    auucu ucucuaa    acuuuca                                c
   |||| || ||||||||||||||||||||    ||||| |||||||    |||||||                                u
   cugu ac ucgguuucuacugaacggcu    uggga agggauu    ugaaagu                                a
uau    -  a                    uaaa     u       ucug       guuaucacaagauauauuaguuuacguauaua 
Get sequence
Confidence
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (v1.0) Overlapping transcripts
chr2: 10422863-10423045 [+]
intergenic

Mature sequence gma-miR169b

Accession MIMAT0007356
Sequence

11 - 

cagccaaggaugacuugccga

 - 31

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).