Stem-loop sequence gma-MIR167c

AccessionMI0007210 (change log)
DescriptionGlycine max miR167c stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

30 open access papers mention gma-MIR167c
(203 sentences)

Stem-loop
   u     a            c  c          --         a   uuuuuuuucucaccucucaugccuaauuuuuaagcaccagucauuagagaaaauaauggugaaaaauccaucuauucaauuuuuuuuuucaaauucaagguuuccaguauguaucacuaauggugaaaaaagugauggaa 
5'  uugag gguugaagcugc ag augaucuggu  aaaucacau cuu                                                                                                                                            u
    ||||| |||||||||||| || ||||||||||  ||||||||| |||                                                                                                                                            u
3'  aacuc cuaacuucgacg uc uacuggacua  uuuggugua gaa                                                                                                                                            u
   u     a            u  -          cc         -   uacuauugguuuaacgggaagaccacccaaaggaaauucauaauuaagguuaaauauucagagaaaauaaagaaccgagucuuugaacuucuuuuacuuuugaguuuuuuuuuuuuucauuuaaauuggguacaagaugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr7: 39734580-39734954 [+]
intergenic
Database links

Mature sequence gma-miR167c

Accession MIMAT0007355
Sequence

11 - 

ugaagcugccagcaugaucug

 - 31

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).