Stem-loop sequence gma-MIR164a

AccessionMI0007209 (change log)
Previous IDsgma-MIR164
DescriptionGlycine max miR164 stem-loop
Gene family MIPF0000045; MIR164
Literature search

17 open access papers mention gma-MIR164a
(42 sentences)

Stem-loop
   -   u  u           ca             --uc  -u   aucu 
5'  agc cc uguuggagaag  gggcacgugcaag    uc  ugg    c
    ||| || |||||||||||  |||||||||||||    ||  |||     
3'  uug gg acaaccucuuc  cucgugcacguuu    ag  acc    a
   u   -  c           cc             ccca  uc   guaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr19: 49681250-49681344 [+]
intergenic
Database links

Mature sequence gma-miR164a

Accession MIMAT0007354
Previous IDsgma-miR164
Sequence

11 - 

uggagaagcagggcacgugca

 - 31

Get sequence
Evidence experimental; 454 [1], Northern [1]

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).