Stem-loop sequence gma-MIR162a

AccessionMI0007208 (change log)
Previous IDsgma-MIR162
DescriptionGlycine max miR162a stem-loop
Gene family MIPF0000127; MIR162_1
Literature search

10 open access papers mention gma-MIR162a
(15 sentences)

Stem-loop
   --    a u a          c    c       uc   c  aa  -gu  u 
5'   guga g c cuggaugcag gguu aucgauc  uuc ug  uc   ug u
     |||| | | |||||||||| |||| |||||||  ||| ||  ||   || u
3'   cacu c g gaccuacguc ccaa uagcuag  aag ac  ag   ac a
   cu    - - c          u    a       cu   u  ca  acu  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr6: 20376062-20376163 [-]
intergenic
Database links

Mature sequence gma-miR162a

Accession MIMAT0007353
Previous IDsgma-miR162
Sequence

73 - 

ucgauaaaccucugcaucca

 - 92

Get sequence
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).
2
PMID:22156213 "MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs" Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC Genes Dev. 25:2540-2553(2011).