Stem-loop sequence gma-MIR159c

AccessionMI0007207 (change log)
DescriptionGlycine max miR159c stem-loop
Gene family MIPF0000010; MIR159
Literature search

23 open access papers mention gma-MIR159c
(80 sentences)

Stem-loop
   ---a  c  g            a        gu        ag   c     a    ug  gcu        guu    u   -a    g  aag 
5'     cc aa uuggagcucucu cacuccaa  cugaagga  uga gguag cccu  cu   aauucaug   accu ugg  uuca au   g
       || || |||||||||||| ||||||||  ||||||||  ||| ||||| ||||  ||   ||||||||   |||| |||  |||| ||    
3'     gg uu agccucgaggga gugagguu  gauuuucu  guu ccauc gggg  ga   uuaaguac   uggg acu  aagu ua   a
   uucc  a  a            a        au        -a   -     -    ca  agu        guc    u   ga    g  cga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr16: 2830034-2830218 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR159c
gma-MIR156aachr16: 2833375-2833561 [-]
gma-MIR159cchr16: 2830034-2830218 [-]
Database links

Mature sequence gma-miR159c

Accession MIMAT0007352
Sequence

154 - 

auuggagugaagggagcuccg

 - 174

Get sequence
Evidence experimental; 454 [1], Northern [1]

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).