Stem-loop sequence gma-MIR159b

AccessionMI0007206 (change log)
DescriptionGlycine max miR159b stem-loop
Gene family MIPF0000010; MIR159
Literature search

26 open access papers mention gma-MIR159b
(84 sentences)

Stem-loop
   --aa    aac            g        gu ug     a  ugau       c  ua  g    uu    g u   uc       uu   aa 
5'     accc   uuggaguucccu cacuccaa  c  aaagg ua    gguaaac uc  cu cuag  caug a acc  ugacuuc  aac  c
       ||||   |||||||||||| ||||||||  |  ||||| ||    ||||||| ||  || ||||  |||| | |||  |||||||  |||  a
3'     uggg   gaccucgaggga gugagguu  g  uuucu gu    ccauuug ag  ga gguc  guac u ugg  acugaag  uug  u
   cuua    --a            a        au gu     a  ---u       -  ua  g    cc    g u   ga       -c   cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Glycine_max_v2.0; GCA_000004515.3) Overlapping transcripts
chr7: 5424789-5424974 [-]
intergenic
Clustered miRNAs
< 10kb from gma-MIR159b
gma-MIR156zchr7: 5432656-5432842 [-]
gma-MIR159bchr7: 5424789-5424974 [-]
gma-MIR156abchr7: 5415191-5415378 [+]
Database links

Mature sequence gma-miR159b-5p

Accession MIMAT0020934
Sequence

13 - 

gaguucccugcacuccaaguc

 - 33

Get sequence
Evidence experimental; Illumina [2]

Mature sequence gma-miR159b-3p

Accession MIMAT0007351
Previous IDsgma-miR159b
Sequence

156 - 

auuggagugaagggagcucca

 - 176

Get sequence
Evidence experimental; 454 [1], Illumina [2]

References

1
PMID:18402695 "Novel and nodulation-regulated microRNAs in soybean roots" Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O BMC Genomics. 9:160(2008).
2
PMID:21663675 "Identification of novel soybean microRNAs involved in abiotic and biotic stresses" Kulcheski FR, de Oliveira LF, Molina LG, Almerao MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimaraes FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R BMC Genomics. 12:307(2011).