Stem-loop sequence csa-mir-34

AccessionMI0007188 (change log)
DescriptionCiona savignyi miR-34 stem-loop
Gene family MIPF0000039; mir-34
Stem-loop
   auucacgugauucugaggc       uu  c         ---ucuuau    -     uu 
5'                    aguguag  ag uaguuguuu         ccgg guggg  u
                      |||||||  || |||||||||         |||| |||||  g
3'                    ucacguu  uc aucaacaaa         ggcu caccc  u
   ------------------a       uu  -         uauacuuuu    a     ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CSAV2.0) Overlapping transcripts
reftig_0: 1439035-1439136 [+]
intergenic
Database links

Mature sequence csa-miR-34

Accession MIMAT0006122
Sequence

16 - 

aggcaguguaguuagcuaguug

 - 37

Get sequence
Evidence by similarity; MI0007158

References

1
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).