Stem-loop sequence csa-mir-31

AccessionMI0007187 (change log)
DescriptionCiona savignyi miR-31 stem-loop
Gene family MIPF0000064; mir-31
Stem-loop
   auguga     a   u   a             g    aaaaa 
5'       cuagc cua ggc agauguuggcaua cuau     u
         ||||| ||| ||| ||||||||||||| ||||     g
3'       gaucg ggu ccg ucuguaaucgugu gaua     u
   ------     c   u   a             -    caaau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CSAV2.0) Overlapping transcripts
reftig_48: 895318-895399 [-]
intergenic
Database links

Mature sequence csa-miR-31

Accession MIMAT0006121
Sequence

16 - 

uggcaagauguuggcauagcu

 - 36

Get sequence
Evidence by similarity; MI0007142

References

1
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).