Stem-loop sequence csa-let-7c-2

Accession MI0007184
Description Ciona savignyi let-7c-2 stem-loop
Gene family MIPF0000002; let-7
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled let-7_microRNA_precursor. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The Let-7 microRNA precursor was identified from a study of developmental timing in C. elegans, and was later shown to be part of a much larger class of non-coding RNAs termed microRNAs. miR-98 microRNA precursor from human is a let-7 family member. Let-7 miRNAs have now been predicted or experimentally confirmed in a wide range of species (MIPF000002). miRNAs are initially transcribed in long transcripts (up to several hundred nucleotides) called primary miRNAs (pri-miRNAs), which are processed in the nucleus by Drosha and Pasha to hairpin structures of about ~70 nucleotide. These precursors (pre-miRNAs) are exported to the cytoplasm by exportin5, where they are subsequently processed by the enzyme Dicer to a ~22 nucleotide mature miRNA. The involvement of Dicer in miRNA processing demonstrates a relationship with the phenomenon of RNA interference.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
cuc   c      cau   g                 -------ug     aau 
   uug ugauaa   gag uaguagguuaugcaguu         gcgac   a
   ||| ||||||   ||| |||||||||||||||||         |||||    
   aac gcuauu   cuc gucguucaaugugucaa         cguug   u
cuc   a      -uu   g                 uagaggaaa     cuu 
Get sequence
Genome context
Coordinates (CSAV2.0) Overlapping transcripts
reftig_41: 1117496-1117597 [+]
intergenic
Clustered miRNAs
< 10kb from csa-let-7c-2
csa-let-7c-1 reftig_41: 1114139-1114239 [+]
csa-let-7b reftig_41: 1115604-1115705 [+]
csa-let-7a reftig_41: 1116068-1116169 [+]
csa-let-7c-2 reftig_41: 1117496-1117597 [+]

Mature sequence csa-let-7c

Accession MIMAT0006118
Sequence

16 - 

ugagguaguagguuaugcaguu

 - 37

Get sequence
Evidence by similarity; MI0007138

References

1
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).