Stem-loop sequence cin-mir-219

AccessionMI0007178 (change log)
DescriptionCiona intestinalis miR-219 stem-loop
Gene family MIPF0000044; mir-219
Stem-loop
   -----------------auggcgucuguuuc u   u     a      g u    uuu 
5'                                g gau gucca acgcaa c cagu   a
                                  | ||| ||||| |||||| | ||||    
3'                                c cua caggu uguguu g guca   a
   aaccaaaaacuucugucgucggaagacuaaa u   -     c      a c    uaa 
Get sequence
Deep sequencing
3572 reads, 1.3e+03 reads per million, 2 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JGI2) Overlapping transcripts
7q: 5634284-5634385 [+]
intergenic
Database links

Mature sequence cin-miR-219-5p

Accession MIMAT0006113
Previous IDscin-miR-219
Sequence

16 - 

ugauuguccaaacgcaagcucag

 - 38

Get sequence
Deep sequencing3232 reads, 2 experiments
Evidence experimental; Illumina [2]

Mature sequence cin-miR-219-3p

Accession MIMAT0015264
Previous IDscin-miR-219*
Sequence

51 - 

gcgauugugucuggacaucu

 - 70

Get sequence
Deep sequencing339 reads, 2 experiments
Evidence experimental; Illumina [2]

References

1
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).
2