Stem-loop sequence cin-mir-200

Accession MI0007175
Description Ciona intestinalis miR-200 stem-loop
Gene family MIPF0000491; mir-200
Community annotation

This text is a summary paragraph taken from the Wikipedia entry entitled mir-8/mir-141/mir-200_microRNA_precursor_family. miRBase and Rfam are facilitating community annotation of microRNA families and entries in Wikipedia. Read more ...

The miR-8 microRNA precursor (homologous to miR-141, miR-200, miR-236), is a short non-coding RNA gene involved in gene regulation. miR-8 in Drosophila melanogaster is expressed from the 3' arm of related precursor hairpins (represented here), along with miR-200, miR-236, miR-429 and human and mouse homolog miR-141. Members of this precursor family have now been predicted or experimentally confirmed in a wide range of species. The bounds of the precursors are predicted based on conservation and base pairing and are not generally known. The miR-200 family is highly conserved in bilaterian animals, with miR-8 as the sole homolog in Drosophila. This species has accordingly been used heavily in work looking to uncover the biological function of the miR-200 family. miR-8 has been observed at all developmental stages of the embryo, with a complete absence from cultured S2 cells of D. melanogaster. Its expression has been seen to be strongly upregulated in larvae and this expression then sustained through to adulthood.

Show Wikipedia entry View @ Wikipedia Edit Wikipedia entry
Stem-loop
uu    -   a  g        --    c       cg  g     
  cgug cca cc aaucacca  acca guaguau  ga cauu 
  |||| ||| || ||||||||  |||| |||||||  || ||| g
  gcau ggu gg uuaguggu  uggu cgucaua  cu gugu 
au    a   -  g        aa    c       au  -     
Get sequence
Genome context
Coordinates (JGI2) Overlapping transcripts
scaffold_71: 128174-128259 [+]
intergenic
Clustered miRNAs
< 10kb from cin-mir-200
cin-mir-200 scaffold_71: 128174-128259 [+]
cin-mir-3575 scaffold_71: 128186-128245 [-]
cin-mir-141 scaffold_71: 128547-128621 [+]
cin-mir-5611 scaffold_71: 128684-128755 [+]
Database links

Mature sequence cin-miR-200-5p

Accession MIMAT0015263
Previous IDs cin-miR-200*
Sequence

16 - 

ucaccaaccacguaguaucg

 - 35

Get sequence
Evidence experimental; Solexa [3]

Mature sequence cin-miR-200-3p

Accession MIMAT0006110
Previous IDs cin-miR-200
Sequence

50 - 

uaauacugccugguaaugguga

 - 71

Get sequence
Evidence experimental; Northern [1], Solexa [3]

References

1
PMID:18047675 "Computational prediction and experimental validation of Ciona intestinalis microRNA genes" Norden-Krichmar TM, Holtz J, Pasquinelli AE, Gaasterland T BMC Genomics. 8:445(2007).
2
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).
3