Stem-loop sequence cin-mir-184

AccessionMI0007173 (change log)
DescriptionCiona intestinalis miR-184 stem-loop
Gene family MIPF0000059; mir-184
Stem-loop
   -------      u  aa    c  c       cuu       ---u      guu 
5'        gcguaa ag  cuug ca uucuucg   uccauca    uuuggg   a
          |||||| ||  |||| || |||||||   |||||||    ||||||   a
3'        ugcguu uc  gaau gu aagaggc   agguagu    gaaccc   a
   aacuggu      c  gg    a  c       ---       uacc      acu 
Get sequence
Deep sequencing
92 reads, 50 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence cin-miR-184

Accession MIMAT0006108
Sequence

66 - 

uggacggagaacugauaagggc

 - 87

Get sequence
Deep sequencing92 reads, 2 experiments
Evidence experimental; Illumina [2]

References

1
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).
2