Stem-loop sequence odi-mir-281

AccessionMI0007148 (change log)
DescriptionOikopleura dioica miR-281 stem-loop
Gene family MIPF0000087; mir-46
Stem-loop
   uucauuuaucaag  u  a    aa   ga     ag        ---------    g 
5'              gc ga agca  aag  ggcaa  uucaugau         uguc a
                || || ||||  |||  |||||  ||||||||         ||||  
3'              cg uu ucgu  uuc  ucguu  agguacug         acag a
   ---------caaa  u  c    ag   uc     -a        ucauaagga    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence odi-miR-281

Accession MIMAT0006085
Sequence

66 - 

ugucauggaauugcucucuug

 - 86

Get sequence
Evidence experimental; cloned [1]

References

1
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).