Stem-loop sequence ssc-mir-99b

AccessionMI0007077 (change log)
DescriptionSus scrofa miR-99b stem-loop
Gene family MIPF0000033; mir-10
Literature search

10 open access papers mention ssc-mir-99b
(15 sentences)

Stem-loop
        cc         ac   c    c - -   c 
5' ggcac  acccguaga  cga cuug g g ggc u
   |||||  |||||||||  ||| |||| | | |||  
3' cugug  ugggugucu  gcu gaac c c ccg u
        cc         gu   c    a a g   c 
Get sequence
Deep sequencing
16046 reads, 2.84e+03 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Sscrofa10.2; GCA_000003025.4) Overlapping transcripts
chr6: 51858217-51858286 [+]
intergenic
Clustered miRNAs
< 10kb from ssc-mir-99b
ssc-mir-99bchr6: 51858217-51858286 [+]
ssc-let-7echr6: 51858376-51858455 [+]
ssc-mir-125achr6: 51858852-51858931 [+]
Database links

Mature sequence ssc-miR-99b

Accession MIMAT0006018
Sequence

7 - 

cacccguagaaccgaccuugcg

 - 28

Get sequence
Deep sequencing15965 reads, 15 experiments
Evidence experimental; Illumina [2-4]

References

1
" Podolska A, Cirera S Unpublished.
2
PMID:19917043 "MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing" Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B Anim Genet. 41:159-168(2010).
3
PMID:21312241 "MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing" Li G, Li Y, Li X, Ning X, Li M, Yang G J Cell Biochem. 112:1318-1328(2011).
4
PMID:24499489 "Exploration of microRNAs in porcine milk exosomes" Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL BMC Genomics. 15:100(2014).