Stem-loop sequence hsa-mir-1470

AccessionMI0007075 (change log)
Symbol HGNC:MIR1470
DescriptionHomo sapiens miR-1470 stem-loop
Literature search

2 open access papers mention hsa-mir-1470
(12 sentences)

Stem-loop
   -g      -   -  -   -a   -     - a 
5'   cccucc gcc cg ugc  ccc cgggg c g
     |||||| ||| || |||  ||| ||||| |  
3'   gggggg ugg gc gcg  ggg gcccc g g
   ca      a   a  c   ca   c     a a 
Get sequence
Deep sequencing
37 reads, 0 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr19: 15449548-15449608 [+]
intergenic
Database links

Mature sequence hsa-miR-1470

Accession MIMAT0007348
Sequence

1 - 

gcccuccgcccgugcaccccg

 - 21

Get sequence
Evidence experimental; cloned [1]
Predicted targets

References

1
PMID:18402656 "Hidden layers of human small RNAs" Kawaji H, Nakamura M, Takahashi Y, Sandelin A, Katayama S, Fukuda S, Daub CO, Kai C, Kawai J, Yasuda J, Carninci P, Hayashizaki Y BMC Genomics. 9:157(2008).