Stem-loop sequence gga-mir-1462

AccessionMI0007067 (change log)
DescriptionGallus gallus miR-1462 stem-loop
Stem-loop
   -     -u  ugagu     u   u c    cu   -  -u       u  uaccuc 
5'  ggcag  gc     gcagc cuc c cugg  uuc ca  gacaggu gg      u
    |||||  ||     ||||| ||| | ||||  ||| ||  ||||||| ||       
3'  ucguc  ug     cgucg gag g gacc  gag gu  cugucua cc      c
   c     uc  --ugu     u   u a    cc   u  uc       u  uuccua 
Get sequence
Deep sequencing
77 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr4: 8548164-8548273 [-]
sense
ENSGALT00000011155 ; DACH2-201; intron 1
Database links

Mature sequence gga-miR-1462-5p

Accession MIMAT0007340
Sequence

27 - 

uggcuuuccaugacagguugg

 - 47

Get sequence
Deep sequencing69 reads, 2 experiments
Evidence experimental; 454 [1], Illumina [2]
Predicted targets

Mature sequence gga-miR-1462-3p

Accession MIMAT0026764
Sequence

64 - 

uaucuguccuugugagccccaga

 - 86

Get sequence
Deep sequencing5 reads, 1 experiments
Evidence experimental; Illumina [2]
Predicted targets

References

1
PMID:18430245 "Deep sequencing of chicken microRNAs" Burnside J, Ouyang M, Anderson A, Bernberg E, Lu C, Meyers BC, Green PJ, Markis M, Isaacs G, Huang E, Morgan RW BMC Genomics. 9:185(2008).
2
PMID:23034410 "Birth and expression evolution of mammalian microRNA genes" Meunier J, Lemoine F, Soumillon M, Liechti A, Weier M, Guschanski K, Hu H, Khaitovich P, Kaessmann H Genome Res. 23:34-45(2013).