Stem-loop sequence gga-mir-1458

AccessionMI0007063 (change log)
DescriptionGallus gallus miR-1458 stem-loop
Literature search

1 open access papers mention gga-mir-1458
(4 sentences)

Stem-loop
   uua  -uc   -   ----          -    -  --u     a    -auu   ca 
5'    gu   agc cuc    auuuuuuuua gagu uc   ggagu ucuu    gca  a
      ||   ||| |||    |||||||||| |||| ||   ||||| ||||    |||  a
3'    ca   ucg gag    uaaaaagagu cucg ag   ccuua agag    cgu  a
   uca  uuu   c   augu          a    u  ugu     a    gagu   au 
Get sequence
Deep sequencing
5 reads, 0 reads per million, 3 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Gallus_gallus-5.0; GCA_000002315.3) Overlapping transcripts
chr9: 10673202-10673311 [+]
sense
ENSGALT00000004113 ; U2SURP-201; intron 25
Database links

Mature sequence gga-miR-1458

Accession MIMAT0007336
Sequence

67 - 

uuccugugaugcucaugagaa

 - 87

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; 454 [1]
Predicted targets

References

1
PMID:18430245 "Deep sequencing of chicken microRNAs" Burnside J, Ouyang M, Anderson A, Bernberg E, Lu C, Meyers BC, Green PJ, Markis M, Isaacs G, Huang E, Morgan RW BMC Genomics. 9:185(2008).